Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Reduced IRP1 expression mediates resistance to ferroptosis in TMZ-resistant glioblastoma cells (A) Images from transmission electron microscopy showing morphology of mitochondria in U87, U87TR, U251, U251TR cells after TMZ treatment for 24 h. Scale bar, 200 nm (down). (B) Representative confocal images of U87, U87TR, U251 and U251TR cells stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the cells stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of U87, U87TR, U251 and U251TR cells stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the cells stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the cells treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in parental and TR cells was influenced by erastin (10 μM) 24 h assessed by DCF-DA using flow cytometry immunolabelling. (H) Western blot analysis of IRP1 and IRP2 protein levels in parental and TR cells. (I) qRT-PCR to detect IRP1 mRNA levels in parental and TR cells. (J) Kaplan–Meier survival analysis of patient overall survival data based on high versus low expression of IRP1 from the TCGA dataset.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Expressing, Transmission Assay, Electron Microscopy, Staining, Membrane, Flow Cytometry, Western Blot, Quantitative RT-PCR

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Overexpressed IRP1 increases TMZ chemotherapy sensitivity by enhancing ferroptosis, lipid peroxidation and free iron accumulation (A) The cell survival rate was measured after TMZ treatment in U87TR-NC, U87TR-lvIRP1, U251TR-NC and U251TR-lvIRP1 groups. Data are represented as the mean ± SD (n = 6). (B) Representative confocal images of the TR and TR-lvIRP1 groups stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the TR and TR-lvIRP1 groups stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of the TR and TR-lvIRP1 groups stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the TR and TR-lvIRP1 groups stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the cells treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in TR and TR-lvIRP1 groups was influenced by erastin (10 μM) 24 h assessed by DCF-DA using flow cytometry immunolabelling.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Staining, Membrane, Flow Cytometry

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Knockout of IRP1 reduced chemotherapy sensitivity by inhibiting ferroptosis, lipid peroxidation, and free iron accumulation (A) The cell survival rate was measured after TMZ treatment in U87NC, U87KO, U251NC and U251KO groups. Data are represented as the mean ± SD (n = 6). (B) Representative confocal images of the NC and KO groups stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the NC and KO cells stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of the NC and KO cells stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the NC and KO groups stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the sgRNA-IRP1#1 transfected group and the sgRNA-IRP1#1 non-transfected group treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in the sgRNA-IRP1#1 transfected group and the sgRNA-IRP1#1 non-transfected group assessed by DCF-DA using flow cytometry immunolabelling.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Knock-Out, Staining, Membrane, Transfection, Flow Cytometry

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Knockout of IRP1 activates the noncanonical NF-κB pathway through NFKB2 (A) Clustering heatmap of mRNA from the NC and KO cells on the basis of differential expression analysis. Control group: n = 3; IRP1 KO group: n = 3. (B) Volcano plot displays differential genes expression in U87KO cells. Up (red), down (blue). (C) KEGG pathway analysis of upregulated genes. Tops of enriched pathway are shown. (D) Western blot to detect major protein levels in the canonical NF-κB pathway in U87NC, U87KO, U251NC and U251KO cells. (E) Western blot to detect major protein levels in the noncanonical NF-κB pathway in U87NC, U87KO, U251NC and U251KO cells. (F) qRT-PCR to detect the NFKB1 mRNA levels in U87NC, U87KO, U251NC and U251KO cells. (G) qRT-PCR to detect the NFKB2 mRNA levels in U87NC, U87KO, U251NC and U251KO cells. (H) IF confocal images of IRP1 (green), NFKB2 (red), and nuclei (blue). Scale bar, 20 μm.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Knock-Out, Quantitative Proteomics, Control, Expressing, Western Blot, Quantitative RT-PCR

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Knockdown of NFKB2 enhanced ferroptosis sensitivity and reversed TMZ resistance (A) The cell survival rate was measured after TMZ treatment in U87KO-NC, U87KO-shNFKB2, U251KO-NC and U251KO-shNFKB2 groups. Data are represented as the mean ± SD (n = 6). (B) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the shRNA-NFKB2 transfected group and the shRNA-NFKB2 non-transfected group treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in the shRNA-NFKB2 transfected group and the shRNA-NFKB2 non-transfected group assessed by DCF-DA using flow cytometry immunolabelling.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Knockdown, Staining, Membrane, shRNA, Transfection, Flow Cytometry

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: High expression of NFKB2 activates LCN2/FPN1 to mediate ferroptosis resistance in GBM cells (A) Western Blot analysis detected the expression of LCN2 and FPN1 in IRP1-NC and IRP1-KO cells. (B and C) qRT-PCR detected the expression of LCN2 and FPN1 in IRP1-NC and IRP1-KO cells. (D) Western Blot analysis to detect NFKB2 protein levels in parental cells transfected with lv-NFKB2. (E and F) qRT-PCR detected the expression of LCN2 and FPN1 in NC and lvNFKB2 cells. (G) ChIP assay of the enrichment of NFKB2 in the LCN2 and FPN1 promoter region normalized to IgG in U87 cells. (H) Ferrous iron levels detected after overexpression of NFKB2 in parental cells. (I) MDA levels detected after overexpression of NFKB2 in parental cells. (J) DCF levels detected after overexpression of NFKB2 in parental cells. (K) Western Blot analysis detected the expression of LCN2 and FPN1 in IRP1-KO-NC and IRP1-KO-shNFKB2 cells. (L and M) qRT-PCR detected the expression of LCN2 and FPN1 in IRP1-KO-NC and IRP1-KO-shNFKB2 cells. (N) Ferrous iron levels detected after knockdown of NFKB2 in IRP1-KO cells. (O) MDA levels detected after knockdown of NFKB2 in IRP1-KO cells. (P) DCF levels detected after knockdown of NFKB2 in IRP1-KO cells.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Expressing, Western Blot, Quantitative RT-PCR, Transfection, Over Expression, Knockdown

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Overexpressed IRP1 enhances ferroptosis-based TMZ antitumor therapy in vivo (A) Schematic illustration of the GBM orthotopic xenograft model. (B) Bioluminescence images of tumor growth after tumor implantation. n = 6 for each group. (C) Tumor growth curves by quantification of bioluminescent imaging signal intensities. Data were represented as the mean ± SD (n = 6). (D) Mice body weight curves started with the generation of xenograft model. Data were represented as the mean ± SD (n = 6). (E) Kaplan-Meier survival curve of nude mice. Data are represented as the mean ± SD (n = 6). (F) Representative images of H&E staining showing tumor volume in the nude mice. (G) IHC staining for Ki67 in brain tumor samples. Scale bar, 50 μm. (H) Relative level of Ferrous iron in brain tumor samples. (I) Relative level of MDA in brain tumor samples.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: In Vivo, Tumor Implantation, Imaging, Staining, Immunohistochemistry

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: The schematic model describes how ferroptosis which IRP1 mediated affects the progression of TMZ resistance in GBM cells via regulating the noncanonical NF-κB pathway

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques:

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet:

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Virus, Recombinant, Membrane, CCK-8 Assay, Lysis, BIA-KA, Multiple Displacement Amplification, GSSG Assay, Iron Assay, Fluorescence, CRISPR, Sequencing, shRNA, Software

Journal: bioRxiv

Article Title: Transcriptomic analysis of pathways associated with αv integrin-related non-canonical autophagy in human B cells

doi: 10.1101/2021.08.02.452710

Figure Lengend Snippet: HBL1 parental cell line and cell lines with ATG5 -CRISPR, ITGA V-CRISPR or ATG7- CRISPR were stimulated with either CpG 2395 or 2006 for 3h or left unstimulated and subjected to RNA-seq. Data are all from 3 technical replicates for each condition: unstimulated or stimulated for each cell line, used for RNA-sequencing experiment. Stimulation data includes samples stimulated with CpG 2395 and CpG 2006. (A) Heat map of genes induced upon stimulation in the parental cells and /or the ATG5 knockout cells. Genes were hierarchically clustered using Euclidean distance & complete linkage; colors represent scaled gene expression values. Data generated from three replicates of unstimulated or stimulated parental cells or knockout cells. (B) Individual gene plots showing batch corrected and normalized log2 counts for gene expression. Each dot represents data from a single sample from each cell line and data from n=3 experiments are plotted p -values are based on multiple t tests corrected for using Benjamini and Hochberg’s methods and presented as * ( p <0.05) or ** ( p <0.01) ***( p <0.001). (C) Volcano plots showing different expressed genes between combined unstimulated parental cells and combined knockout cells (pooled knockout. Highlighted are genes from the autophagy associated or autophagy regulated sets from the tonsil analysis that also showed significant changes in the combined unstimulated knockout cells. (D) Genes significantly up-regulated or down-regulated by 1.5 fold in the unstimulated knockout cells from the autophagy regulated set are plotted as a network, and the known function of these genes are highlighted based on the string pathway analysis tool. ( E ) Volcano plot showing changes in gene module expression between combined unstimulated parental lines and combined unstimulated knockout cell lines. Dashed line represents significance threshold FDR < 0.001; modules of interest are highlighted. (F) Genes significantly upregulated (≥ 1.5-fold) in the unstimulated knockout cells from G2M checkpoint module and mitotic spindle gene set enrichment analysis modules are plotted as a network, and the known function of these genes are highlighted based on the string pathway analysis tool. (G) Volcano plots showing differentially expressed genes between combined unstimulated parental cells and combined knockout cells (pooled knockout) or the genes differentially expressed in GC B cells upon stimulation compared to unstimulated cells. Highlighted are the genes from the G2M checkpoint module and the SMAD3 module. Data are representative of replicates from each cell line or 5 different donor tonsil samples.

Article Snippet: PCR products were purified using GeneJet PCR Purification Kit (Thermo Fisher Scientific) and analyzed by Sanger Sequencing and Inference of CRISPR Edits (ICE; ice.synthego.com ).

Techniques: CRISPR, RNA Sequencing, Knock-Out, Gene Expression, Generated, Expressing

Journal: Cell Reports

Article Title: HLA class-I-peptide stability mediates CD8 + T cell immunodominance hierarchies and facilitates HLA-associated immune control of HIV

doi: 10.1016/j.celrep.2021.109378

Figure Lengend Snippet:

Article Snippet: Sequence data of CRISPR amplicons of the TAP1 gene is available at Mendeley Data ( https://doi.org/10.17632/hh46ymyxkk.1 ).

Techniques: Labeling, Recombinant, CRISPR, Amplification, Sequencing, Plasmid Preparation, Construct

Journal: Scientific Reports

Article Title: LncRNA CCAT1 enhances chemoresistance in hepatocellular carcinoma by targeting QKI-5

doi: 10.1038/s41598-022-11644-4

Figure Lengend Snippet: CCAT1 enhanced HCC resistance to oxaliplatin in vitro. ( A ) HCC cells received OXA treatment for 48 h, the expression of CCAT1 was determined by qRT-PCR. ( B , C ) HCCLM3 and HepG2 HCC cell lines were knocked out of CCAT1 and exposed to increasing concentrations of oxaliplatin from 0.1 to 1 mM for 48 h to determine the IC50 values by CCK-8 assay. (IC50 of HCCLM3 control and KO-CCAT1: 46.56 vs. 23.22 μM; HepG2 control and KO-CCAT1: IC50: 27.98 vs. 13.28 μM, p < 0.01 respectively). ( D ) The colony formation assay showed that the numbers of colonies were reduced when CCAT1 was knocked out. ( E ) Significantly increased proportion of apoptotic cells by in the KO-CCAT1 groups. ( F ) Significantly increased caspase-3 activation following knock out of CCAT1, indicated by red fluorescence staining ( p < 0.01). ( G ) Caspase-3 and caspase-7 activities were measured by Caspase-Glo® 3/7 Assay ( p < 0.05).

Article Snippet: CRISPR guide RNA specifically targeting CCAT1 sequence (forward gRNA GCCCCTGGCCAACTATATCT; reverse gRNA ATTTGGTCATAATGCGGAAA) was constructed by Genechem (Shanghai, China) and transfected into the above cells.

Techniques: In Vitro, Expressing, Quantitative RT-PCR, CCK-8 Assay, Control, Colony Assay, Activation Assay, Knock-Out, Fluorescence, Staining, Caspase-Glo Assay

Journal: Scientific Reports

Article Title: LncRNA CCAT1 enhances chemoresistance in hepatocellular carcinoma by targeting QKI-5

doi: 10.1038/s41598-022-11644-4

Figure Lengend Snippet: CCAT1 involved in HCC resistance to oxaliplatin in vivo . All groups received intraperitoneal injections of OXA (0.8 mg/kg/w). ( A ) Tumor growth curves of subcutaneous implantation models of HCC. ( B ) The average tumor volumes were calculated using the following formula: V(mm 3 ) = (L × W 2 ) × 0.5 (L: tumor length, W: width). ( C ) TUNEL assay was applied to detect HCC apoptosis in subcutaneous implantation tumor (Original magnification: × 200). ( D ) Immunohistochemistry staining for Bel-2 and active caspase-3 expressions in subcutaneous tumor (Original magnification: × 400). * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: CRISPR guide RNA specifically targeting CCAT1 sequence (forward gRNA GCCCCTGGCCAACTATATCT; reverse gRNA ATTTGGTCATAATGCGGAAA) was constructed by Genechem (Shanghai, China) and transfected into the above cells.

Techniques: In Vivo, TUNEL Assay, Immunohistochemistry, Staining

Journal: Scientific Reports

Article Title: LncRNA CCAT1 enhances chemoresistance in hepatocellular carcinoma by targeting QKI-5

doi: 10.1038/s41598-022-11644-4

Figure Lengend Snippet: CCAT1 interacted with QKI-5. ( A ) Subcellular localization plots displayed by lncATLAS. ( B ) This nuclear location was confirmed by the cytoplasmic and nuclear extracts measured from qRT-PCR. ( C ) RNA-binding proteins of CCAT1 was predicted by RBPDB ( http://rbpdb.ccbr.utoronto.ca/ ) database. ( D ) Immunohistochemistry staining indicated that QKI-5 was located in the nucleus (Original magnification: × 400). ( E ) CCAT1 was enriched with QKI-5-immunoprecipitation. RNA pull-down assay was applied to detect the QKI-5 antibody.

Article Snippet: CRISPR guide RNA specifically targeting CCAT1 sequence (forward gRNA GCCCCTGGCCAACTATATCT; reverse gRNA ATTTGGTCATAATGCGGAAA) was constructed by Genechem (Shanghai, China) and transfected into the above cells.

Techniques: Quantitative RT-PCR, RNA Binding Assay, Immunohistochemistry, Staining, Immunoprecipitation, Pull Down Assay

Journal: Scientific Reports

Article Title: LncRNA CCAT1 enhances chemoresistance in hepatocellular carcinoma by targeting QKI-5

doi: 10.1038/s41598-022-11644-4

Figure Lengend Snippet: Overexpression of QKI-5 reversed oxaliplatin resistance induced by CCAT1. ( A ) Western blotting analysis of expression levels of QKI-5, JNK, p-JNK, ERK1/2, p-ERK1/2, p38 and p-p38 MAPK in control and pcDNA3.1-QKI-5 cells. ( B ) The phosphorylation and total levels of p38 MAPK in the CCAT1 and QKI-5 overexpression HCC cells. ( C ) IC50 of oxaliplatin was determined when QKI-5 was upregulated. ( D ) The colony formation assay showed that overexpressed QKI-5 significantly attenuated cell proliferation induced by CCAT1 both in HCCLM3 and HepG2 cells. ( E , F ) Fluorescence staining and Caspase-Glo® 3/7 Assay showed caspase-3 activity influenced by CCAT1 and QKI-5. Overexpressed QKI-5 could increase caspase-3 activity reduced by CCAT1. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: CRISPR guide RNA specifically targeting CCAT1 sequence (forward gRNA GCCCCTGGCCAACTATATCT; reverse gRNA ATTTGGTCATAATGCGGAAA) was constructed by Genechem (Shanghai, China) and transfected into the above cells.

Techniques: Over Expression, Western Blot, Expressing, Control, Phospho-proteomics, Colony Assay, Fluorescence, Staining, Caspase-Glo Assay, Activity Assay

Journal: Scientific Reports

Article Title: Genomic insertion of ancestral uricase into human liver cells to determine metabolic consequences of pseudogenization

doi: 10.1038/s41598-025-10551-8

Figure Lengend Snippet: Schematic for CRISPR/Cas9 system into human AAVS1 locus. Top: Human AAVS1 locus. Single guide RNA (sgRNA) is indicated above the AAVS1 locus. Center: Donor DNA with 5’ homology arm (HA) and 3’HA, ∼820 bp on each side (dashed lines), splice acceptor sequence, T2A ribosome-skipping sequences, puromycin resistance sequence, Red Fluorescent Protein sequence (RFP), ancestral uricase sequence (AncUOX), and polyA signal. Bottom: Cas9 cleavage at the cut site allows donor DNA to be integrated via homology directed repair (HDR). After HDR the engineered AAVS1 locus is able to expresses Puromycin-resistance protein, RFP, and AncUOX.

Article Snippet: The DNA CRISPR Donor sequence generated and analyzed during the current study is available in the National Center for Biotechnology Information (NCBI) at the National Institutes of Health, Accession PQ792649 .

Techniques: CRISPR, Sequencing

Journal: iScience

Article Title: Glycogen synthase kinase 3 inhibition controls Mycobacterium tuberculosis infection

doi: 10.1016/j.isci.2024.110555

Figure Lengend Snippet: Intracellular screening of kinase inhibitor libraries identified GSK3β as a key host controller of Mtb infection (A) Screening of 313 unique compounds from the PKIS/UNC library at 10 μM concentration against THP-1 cells infected with RFP-expressing intracellular Mtb, using the CellInsight CX5 HCS platform (CX5). Z’ = 0.58 ± 0.12 across 8 plates. Mtb % inhibition, calculated based on the intracellular fluorescence intensity dual normalized to the BDQ positive control (100% inhibition) and the negative DMSO vehicle control (0% inhibition), was plotted as a function of THP-1 cell survival as measured by DAPI-stained nuclei cell counts compared to the negative control. Green circles in upper right quadrant represent compounds with greater than 20% Mtb inhibition and 70% THP-1 survival. (B) Distribution of GSK3β inhibitors based on their intracellular inhibition of Mtb. GSK3 inhibitors from the above library were rescreened against luciferase-expressing Mtb in THP-1 cells using a luciferase assay. Mtb % inhibition was calculated based on the relative luminescence, dual normalized to the Rifampicin positive control (100% inhibition) and the negative DMSO control (0% inhibition). Over half of the tested compounds (22/42) demonstrated at least 20% inhibition of Mtb intracellular growth. Z’ = 0.56. (C) Screening of a GSK3β focused library of compounds (Takeda) at 10 μM against luciferase-expressing Mtb in THP-1 macrophages using a luciferase assay. Mtb % inhibition (as calculated in B) was plotted as a function of THP-1 cell survival as determined by MTT assay. Green circles in upper right quadrant represent compounds with greater than 50% Mtb inhibition and 70% THP-1 survival; compound P-4423632 circled. (D–G) Dose-dependent inhibitory activity of four select GSK3 inhibitors against intracellular Mtb and the corresponding compound structures (inset). THP-1 cells infected with luciferase-expressing Mtb were treated with 2-fold serial dilutions of the indicated compounds. Mtb % inhibition was calculated as in (B). Non-linear regression (variable slope) was used to fit the data of the log (inhibitor) vs. response (±SD) using GraphPad Prism software; N = 3.

Article Snippet: GSK3α CRISPR Sequencing For primer: CCTTCTCTTCTGGCCCATGG , Synthego , N/A.

Techniques: Infection, Concentration Assay, Expressing, Inhibition, Fluorescence, Positive Control, Control, Staining, Negative Control, Luciferase, MTT Assay, Activity Assay, Software

Journal: iScience

Article Title: Glycogen synthase kinase 3 inhibition controls Mycobacterium tuberculosis infection

doi: 10.1016/j.isci.2024.110555

Figure Lengend Snippet: Genetic validation of GSK3’s role in restricting Mtb intracellular growth (A) Inhibition of intracellular Mtb by downregulating GSK3 isoforms using siRNA. GSK3α, GSK3β or both were knocked down in THP-1 cells, followed by infection with Mtb. Inhibition % represents the % of Mtb fluorescence area and relative luminescence compared to BDQ control (100% inhibition) and normalized to cells transfected with scrambled siRNA (0% inhibition). Data represent mean ± SEM of 3 biological replicates using high-content analysis (CX5) and luciferase assay; statistics were performed using one-way ANOVA followed by Bonferroni’s post hoc test compared to the scrambled siRNA control (not shown); ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001. (B) Confirmation using qPCR of siRNA knockdown of GSK3α and GSK3β RNA levels in THP-1cells following transfection with GSK3α siRNA (red), GSK3β siRNA (blue), and both GSK3α and GSK3β siRNA (purple); siRNA transfection is indicated. Fold expression represent the GSK3 variant expression levels in cells transfected with the indicated GSK3 siRNA compared to transfection with scrambled siRNA control, defined at 1 (not shown). Data represent the mean +SD of a representative experiment. N = 4 . Statistics were performed using two-way ANOVA followed by Bonferroni’s post hoc test compared to the scrambled siRNA control; ∗∗∗ p < 0.001. (C) Mtb infection of CRISPR-inactivated GSK3α (red) or GSK3β (blue) in THP-1 cells showing the effect of gene disruption with and without 72h P-4423632 treatment. Parental, GSK3α and GSK3β knockout THP-1 cells were infected with RFP-expressing Mtb and treated with 10 μM P-4423632 (right group) or DMSO control (Untreated, left group). Data represent high-content analysis of intracellular fluorescence area dual normalized to untreated (DMSO vehicle control) parental THP-1 cells (defined as 100% Mtb survival) and BDQ-treated parental cells (0% survival). Knocking out GSK3α and GSK3β in THP-1 cells were able to inhibit intracellular survival of Mtb with the greatest effect seen by blocking both GSK3α (by knockout) and GSK3β (by chemical inhibition). Data represent mean ± SEM of 3 biological replicates. Statistics were performed using two-way ANOVA followed by Bonferroni’s post hoc test. ∗ p < 0.05; ∗∗ p < 0.01; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001. (D) Contribution of P-4423632 inhibition of Mtb in parental, GSK3α and GSK3β backgrounds. Treating GSK3α KO cells with 10 μM P-4423632 further inhibited intracellular survival of Mtb by over 75% of its untreated counterpart, similar to the reduction observed in parental cells; whereas addition of P-4423632 to GSK3β KO cells had less of an effect (∼50% reduction). Reduction % was calculated as 100%-treated/untreated data from (C) for each cell type. Statistics were performed using one-way ANOVA. ∗ p < 0.05; ∗∗ p < 0.01.

Article Snippet: GSK3α CRISPR Sequencing For primer: CCTTCTCTTCTGGCCCATGG , Synthego , N/A.

Techniques: Inhibition, Infection, Fluorescence, Control, Transfection, High Content Screening, Luciferase, Knockdown, Expressing, Variant Assay, CRISPR, Disruption, Knock-Out, Blocking Assay

Journal: iScience

Article Title: Glycogen synthase kinase 3 inhibition controls Mycobacterium tuberculosis infection

doi: 10.1016/j.isci.2024.110555

Figure Lengend Snippet: Modulation of macrophage phosphorylation upon infection and treatment with P-4423632 using antibody microarray analysis (A and B) Volcano plots showing log 2 fold change in normalized signal intensity and log 10 p values for modulated protein phosphorylation sites after (A) infection with Mtb and (B) infection with Mtb and treatment with P-4423632. Red and blue labels show significantly up-regulated and down-regulated phosphosites, respectively. Green labels show phosphosites whose phosphorylation levels in relation to infection were noticeably modulated by P-4423632. p values were adjusted using the Benjamini-Hochberg method. (C) Scatterplot showing the ratio of log 2 fold change in phosphorylation after infection or infection plus treatment with P-4423632. p values were calculated using an empirical Bayesian variance estimate derived from Cyber-T method. The solid blue line corresponds to a one-to-one ratio of log 2 fold change while the red dotted lines represent the 97.5% quantiles of the data. The 25 proteins with the largest difference in fold change (distance to the blue line) are labeled in black. (D) Heatmap showing log 2 fold change in relation to non-infected macrophages control. The 25 most modulated phospho-sites between infection and drug treatment were monitored in the labeled samples: P = parental THP-1 cells, KO = GSK3β CRISPR knockout in THP-1 cells, WT = infected with WT Mtb, Δ ptpA = infected with Δ ptpA mutant of Mtb. Row labels include the protein name and the affected phosphorylation site. (E) Network diagram 16 highly modulated proteins from (C) belonging to the GSK3β (blue lines), phagocytosis (green) lines, and apoptosis (red lines), related pathways. Pathways are defined by KEGG with GSK3β related disease specific pathways filtered out. Node and point size in the diagram reflect either the number of pathway groups a protein is present in or the number of proteins present in the pathway group. Visualization and statistical tests for antibody microarray analyses (A–E) were performed using CAT PETR. (F) Western blot analysis of Y279 - Y216 phosphorylation status of GSK3α and GSK3β cells infected with Mtb. P = parental THP-1 cells, KO = GSK3β CRISPR knockout in THP-1 cells, WT = infected with H37Rv WT Mtb, Δ ptpA = infected with Δ ptpA mutant of Mtb. Hsp27 included as loading control.

Article Snippet: GSK3α CRISPR Sequencing For primer: CCTTCTCTTCTGGCCCATGG , Synthego , N/A.

Techniques: Infection, Microarray, Derivative Assay, Labeling, Control, CRISPR, Knock-Out, Mutagenesis, Western Blot

Journal: iScience

Article Title: Glycogen synthase kinase 3 inhibition controls Mycobacterium tuberculosis infection

doi: 10.1016/j.isci.2024.110555

Figure Lengend Snippet:

Article Snippet: GSK3α CRISPR Sequencing For primer: CCTTCTCTTCTGGCCCATGG , Synthego , N/A.

Techniques: Virus, Expressing, Luciferase, Plasmid Preparation, Transformation Assay, Recombinant, Transfection, SYBR Green Assay, Red Blood Cell Lysis, Sequencing, Negative Control, CRISPR, Software